Stem-loop sequence mdo-mir-7388a

AccessionMI0023998 (change log)
DescriptionMonodelphis domestica miR-7388a stem-loop
Stem-loop
   --         -     c  a      aau 
5'   aguuguaca gauau ac uuuuau   u
     ||||||||| ||||| || ||||||    
3'   ucaacaugu cugua ug aaaaua   a
   gg         a     c  a      gua 
Get sequence
Deep sequencing
4859 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40506274-40506332 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7388a
mdo-mir-7386mchrX: 40497149-40497205 [+]
mdo-mir-7386nchrX: 40500911-40500970 [+]
mdo-mir-7371pchrX: 40502424-40502481 [+]
mdo-mir-7386ochrX: 40504972-40505028 [+]
mdo-mir-7388achrX: 40506274-40506332 [+]
mdo-mir-7389chrX: 40514663-40514725 [+]
mdo-mir-7388bchrX: 40516163-40516222 [+]
Database links

Mature sequence mdo-miR-7388a-5p

Accession MIMAT0028868
Sequence

1 - 

aguuguacagauaucacauuu

 - 21

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7388a-3p

Accession MIMAT0028869
Sequence

38 - 

aagucaugucauguacaacugg

 - 59

Get sequence
Deep sequencing4849 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).