Stem-loop sequence mdo-mir-7386o

AccessionMI0023997 (change log)
DescriptionMonodelphis domestica miR-7386o stem-loop
Stem-loop
   --         a       a   ug ua 
5'   uguggacac guccuuc uuu  u  a
     ||||||||| ||||||| |||  |  u
3'   auaccugug uaggaag aaa  g  u
   ag         c       a   gu uu 
Get sequence
Deep sequencing
34991 reads, 1.16e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40504972-40505028 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386o
mdo-mir-7386mchrX: 40497149-40497205 [+]
mdo-mir-7386nchrX: 40500911-40500970 [+]
mdo-mir-7371pchrX: 40502424-40502481 [+]
mdo-mir-7386ochrX: 40504972-40505028 [+]
mdo-mir-7388achrX: 40506274-40506332 [+]
mdo-mir-7389chrX: 40514663-40514725 [+]
Database links

Mature sequence mdo-miR-7386o-5p

Accession MIMAT0028866
Sequence

1 - 

uguggacacaguccuucauuuu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386o-3p

Accession MIMAT0028867
Sequence

36 - 

aaagaaggaucguguccauaga

 - 57

Get sequence
Deep sequencing34991 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).