Stem-loop sequence mdo-mir-7386n

AccessionMI0023996 (change log)
DescriptionMonodelphis domestica miR-7386n stem-loop
Gene family MIPF0001658; mir-7386
Stem-loop
   ugg         u a         gugca 
5'    guggauaag c cuuuacuuu     u
      ||||||||| | |||||||||     u
3'    uaccuauuc g ggaaugaaa     c
   aga         c -         acuuu 
Get sequence
Deep sequencing
2408 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40500911-40500970 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386n
mdo-mir-7386fchrX: 40491868-40491926 [+]
mdo-mir-7386gchrX: 40492022-40492080 [+]
mdo-mir-7386mchrX: 40497149-40497205 [+]
mdo-mir-7386nchrX: 40500911-40500970 [+]
mdo-mir-7371pchrX: 40502424-40502481 [+]
mdo-mir-7386ochrX: 40504972-40505028 [+]
mdo-mir-7388achrX: 40506274-40506332 [+]
Database links

Mature sequence mdo-miR-7386n-5p

Accession MIMAT0028864
Sequence

1 - 

uggguggauaagucacuuuacuuu

 - 24

Get sequence
Deep sequencing139 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386n-3p

Accession MIMAT0028865
Sequence

40 - 

aguaagggccuuauccauaga

 - 60

Get sequence
Deep sequencing2269 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).