Stem-loop sequence mdo-mir-7386m

AccessionMI0023995 (change log)
DescriptionMonodelphis domestica miR-7386m stem-loop
Gene family MIPF0001658; mir-7386
Stem-loop
   --c      a         aa      aa 
5'    auggac auaugcuuc  uuugua  u
      |||||| |||||||||  ||||||  u
3'    uaccug uaugugaag  aaacgu  u
   aga      g         --      ag 
Get sequence
Deep sequencing
5547 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40497149-40497205 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386m
mdo-mir-7386qchrX: 40488023-40488080 [+]
mdo-mir-7386lchrX: 40488792-40488846 [+]
mdo-mir-7371lchrX: 40489392-40489450 [+]
mdo-mir-7386fchrX: 40491868-40491926 [+]
mdo-mir-7386gchrX: 40492022-40492080 [+]
mdo-mir-7386mchrX: 40497149-40497205 [+]
mdo-mir-7386nchrX: 40500911-40500970 [+]
mdo-mir-7371pchrX: 40502424-40502481 [+]
mdo-mir-7386ochrX: 40504972-40505028 [+]
mdo-mir-7388achrX: 40506274-40506332 [+]
Database links

Mature sequence mdo-miR-7386m-5p

Accession MIMAT0028862
Sequence

1 - 

cauggacaauaugcuucaauuugu

 - 24

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386m-3p

Accession MIMAT0028863
Sequence

36 - 

aaagaaguguaugguccauaga

 - 57

Get sequence
Deep sequencing5538 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).