Stem-loop sequence mdo-mir-7386f

AccessionMI0023992 (change log)
DescriptionMonodelphis domestica miR-7386f stem-loop
Gene family MIPF0001658; mir-7386
Stem-loop
   a   --          cuc       ugca 
5'  cuc  ggaugaggca   uauuuug    u
    |||  ||||||||||   |||||||     
3'  ggg  ccuacuccgu   auaaaac    c
   a   uu          -aa       cucc 
Get sequence
Deep sequencing
6799 reads, 220 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40491868-40491926 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386f
mdo-mir-7386jchrX: 40482901-40482958 [+]
mdo-mir-7386kchrX: 40484389-40484445 [+]
mdo-mir-7386dchrX: 40485434-40485494 [+]
mdo-mir-7386echrX: 40485588-40485646 [+]
mdo-mir-7371kchrX: 40486320-40486378 [+]
mdo-mir-7386qchrX: 40488023-40488080 [+]
mdo-mir-7386lchrX: 40488792-40488846 [+]
mdo-mir-7371lchrX: 40489392-40489450 [+]
mdo-mir-7386fchrX: 40491868-40491926 [+]
mdo-mir-7386gchrX: 40492022-40492080 [+]
mdo-mir-7386mchrX: 40497149-40497205 [+]
mdo-mir-7386nchrX: 40500911-40500970 [+]
Database links

Mature sequence mdo-miR-7386f-5p

Accession MIMAT0028856
Sequence

1 - 

acucggaugaggcacucuau

 - 20

Get sequence
Deep sequencing6350 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386f-3p

Accession MIMAT0028857
Sequence

41 - 

aaaugccucauccuuggga

 - 59

Get sequence
Deep sequencing449 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).