Stem-loop sequence mdo-mir-7386h

AccessionMI0023984 (change log)
DescriptionMonodelphis domestica miR-7386h stem-loop
Stem-loop
   --    -         c        -  uuu 
5'   cucu uggauaagg ucuuuauu ug   u
     |||| ||||||||| |||||||| ||    
3'   gaga gccuauucc aggaauga ac   c
   ca    u         -        u  ugu 
Get sequence
Deep sequencing
7176 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40478033-40478091 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386h
mdo-mir-7386pchrX: 40471895-40471952 [+]
mdo-mir-7386a-1chrX: 40472059-40472119 [+]
mdo-mir-7386a-2chrX: 40472371-40472431 [+]
mdo-mir-7386a-3chrX: 40472534-40472593 [+]
mdo-mir-7386bchrX: 40472741-40472797 [+]
mdo-mir-7387chrX: 40473856-40473914 [+]
mdo-mir-7371ochrX: 40474430-40474488 [+]
mdo-mir-7371nchrX: 40476156-40476213 [+]
mdo-mir-7386hchrX: 40478033-40478091 [+]
mdo-mir-7386cchrX: 40478197-40478256 [+]
mdo-mir-7371qchrX: 40479473-40479531 [+]
mdo-mir-7386ichrX: 40481296-40481352 [+]
mdo-mir-7371mchrX: 40481839-40481897 [+]
mdo-mir-7386jchrX: 40482901-40482958 [+]
mdo-mir-7386kchrX: 40484389-40484445 [+]
mdo-mir-7386dchrX: 40485434-40485494 [+]
mdo-mir-7386echrX: 40485588-40485646 [+]
mdo-mir-7371kchrX: 40486320-40486378 [+]
mdo-mir-7386qchrX: 40488023-40488080 [+]
Database links

Mature sequence mdo-miR-7386h-5p

Accession MIMAT0028840
Sequence

1 - 

cucuuggauaaggcucuuuauu

 - 22

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386h-3p

Accession MIMAT0028841
Sequence

38 - 

uaaggaccuuauccguagagac

 - 59

Get sequence
Deep sequencing7168 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).