Stem-loop sequence mdo-mir-7386b

AccessionMI0023982 (change log)
DescriptionMonodelphis domestica miR-7386b stem-loop
Gene family MIPF0001658; mir-7386
Stem-loop
   --agc          a   -ua   u  a 
5'      uggauaaggu cuc   uug ac c
        |||||||||| |||   ||| || g
3'      accuauucca gag   aac ug u
   gagau          c   uaa   -  u 
Get sequence
Deep sequencing
1723 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40472741-40472797 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7386b
mdo-mir-7386pchrX: 40471895-40471952 [+]
mdo-mir-7386a-1chrX: 40472059-40472119 [+]
mdo-mir-7386a-2chrX: 40472371-40472431 [+]
mdo-mir-7386a-3chrX: 40472534-40472593 [+]
mdo-mir-7386bchrX: 40472741-40472797 [+]
mdo-mir-7387chrX: 40473856-40473914 [+]
mdo-mir-7371ochrX: 40474430-40474488 [+]
mdo-mir-7371nchrX: 40476156-40476213 [+]
mdo-mir-7386hchrX: 40478033-40478091 [+]
mdo-mir-7386cchrX: 40478197-40478256 [+]
mdo-mir-7371qchrX: 40479473-40479531 [+]
mdo-mir-7386ichrX: 40481296-40481352 [+]
mdo-mir-7371mchrX: 40481839-40481897 [+]
Database links

Mature sequence mdo-miR-7386b-5p

Accession MIMAT0028836
Sequence

1 - 

agcuggauaagguacucuauu

 - 21

Get sequence
Deep sequencing1695 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7386b-3p

Accession MIMAT0028837
Sequence

37 - 

augagcaccuuauccauagag

 - 57

Get sequence
Deep sequencing28 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).