Stem-loop sequence mdo-mir-7385d

AccessionMI0023978 (change log)
DescriptionMonodelphis domestica miR-7385d stem-loop
Gene family MIPF0001688; mir-7385
Stem-loop
   --     u     u    c    ugugcugu 
5'   agguc gauag cuau uucc        c
     ||||| ||||| |||| ||||         
3'   uccgg cuauc gaua gagg        a
   ag     c     u    c    uucuaaau 
Get sequence
Deep sequencing
13961 reads, 360 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 4611934-4611995 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7385d
mdo-mir-7385achrX: 4607962-4608023 [+]
mdo-mir-7385i-2chrX: 4609054-4609115 [+]
mdo-mir-7385bchrX: 4610588-4610649 [+]
mdo-mir-7385cchrX: 4611475-4611536 [+]
mdo-mir-7385dchrX: 4611934-4611995 [+]
mdo-mir-7385g-1chrX: 4612215-4612274 [+]
mdo-mir-7385echrX: 4614575-4614633 [+]
mdo-mir-7385g-2chrX: 4614848-4614911 [+]
mdo-mir-7385hchrX: 4615421-4615479 [+]
mdo-mir-7385fchrX: 4616510-4616572 [+]
mdo-mir-7385i-1chrX: 4616788-4616846 [+]
mdo-mir-7385g-3chrX: 4617777-4617836 [+]
Database links

Mature sequence mdo-miR-7385d-5p

Accession MIMAT0028832
Sequence

1 - 

aggucugauagucuaucuucc

 - 21

Get sequence
Deep sequencing877 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7385d-3p

Accession MIMAT0028833
Sequence

42 - 

agcauagucuauccggccuga

 - 62

Get sequence
Deep sequencing13083 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).