Stem-loop sequence mdo-mir-7385a

AccessionMI0023975 (change log)
DescriptionMonodelphis domestica miR-7385a stem-loop
Gene family MIPF0001688; mir-7385
Stem-loop
   --          uu    c      u augu 
5'   aggucggaua  cugu uuucag g    u
     ||||||||||  |||| |||||| |    c
3'   uccagucuau  gaca aagguc c    u
   ga          cg    c      - caaa 
Get sequence
Deep sequencing
4063 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 4607962-4608023 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7385a
mdo-mir-7385achrX: 4607962-4608023 [+]
mdo-mir-7385i-2chrX: 4609054-4609115 [+]
mdo-mir-7385bchrX: 4610588-4610649 [+]
mdo-mir-7385cchrX: 4611475-4611536 [+]
mdo-mir-7385dchrX: 4611934-4611995 [+]
mdo-mir-7385g-1chrX: 4612215-4612274 [+]
mdo-mir-7385echrX: 4614575-4614633 [+]
mdo-mir-7385g-2chrX: 4614848-4614911 [+]
mdo-mir-7385hchrX: 4615421-4615479 [+]
mdo-mir-7385fchrX: 4616510-4616572 [+]
mdo-mir-7385i-1chrX: 4616788-4616846 [+]
mdo-mir-7385g-3chrX: 4617777-4617836 [+]
Database links

Mature sequence mdo-miR-7385a-5p

Accession MIMAT0028826
Sequence

1 - 

aggucggauauucugucuuuca

 - 22

Get sequence
Deep sequencing531 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7385a-3p

Accession MIMAT0028827
Sequence

41 - 

gaacacaggcuaucugaccuag

 - 62

Get sequence
Deep sequencing3530 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).