Stem-loop sequence mdo-mir-7384

AccessionMI0023974 (change log)
DescriptionMonodelphis domestica miR-7384 stem-loop
Stem-loop
   --a    gu    auua           -  ga 
5'    gccu  gaug    ucucugauuga cu  c
      ||||  ||||    ||||||||||| ||   
3'    cgga  cuac    agggacuaacu gg  u
   caa    gu    ---a           c  uc 
Get sequence
Deep sequencing
32005 reads, 1.14e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 31175976-31176037 [+]
intergenic
Database links

Mature sequence mdo-miR-7384-5p

Accession MIMAT0028824
Sequence

1 - 

agccugugaugauuaucucuga

 - 22

Get sequence
Deep sequencing31026 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7384-3p

Accession MIMAT0028825
Sequence

44 - 

agggaacaucugaggcaac

 - 62

Get sequence
Deep sequencing978 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).