Stem-loop sequence mdo-mir-7383-5

AccessionMI0023973 (change log)
DescriptionMonodelphis domestica miR-7383-5 stem-loop
Gene family MIPF0001662; mir-7383
Stem-loop
   --c    uac   ag u        uu gu 
5'    aagg   cug  g ccucuuau  u  u
      ||||   |||  | ||||||||  |   
3'    uucc   gac  c ggagaaug  a  u
   ugu    cuc   cu -        uu ga 
Get sequence
Deep sequencing
4093 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 22358078-22358136 [+]
intergenic
Database links

Mature sequence mdo-miR-7383-5p

Accession MIMAT0028822
Sequence

1 - 

caagguaccugagguccucuua

 - 22

Get sequence
Deep sequencing17130 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7383-3p

Accession MIMAT0028823
Sequence

39 - 

agaggcuccagcucccuuugu

 - 59

Get sequence
Deep sequencing3298 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).