Stem-loop sequence mdo-mir-7382

AccessionMI0023968 (change log)
DescriptionMonodelphis domestica miR-7382 stem-loop
Stem-loop
   --       c  uu   g      auagu 
5'   agaggcu cu  cuc aguggg     c
     ||||||| ||  ||| ||||||     u
3'   ucuuuga ga  ggg ucaccc     g
   ug       a  gg   a      aacua 
Get sequence
Deep sequencing
2120 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 70038803-70038861 [-]
sense
ENSMODT00000038770 ; NLGN3-201; intron 3
Database links

Mature sequence mdo-miR-7382-5p

Accession MIMAT0028820
Sequence

1 - 

agaggcuccuuucucgaguggg

 - 22

Get sequence
Deep sequencing57 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7382-3p

Accession MIMAT0028821
Sequence

38 - 

cacuagggggagaaguuucugu

 - 59

Get sequence
Deep sequencing2063 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).