Stem-loop sequence mdo-mir-7381

AccessionMI0023967 (change log)
DescriptionMonodelphis domestica miR-7381 stem-loop
Stem-loop
   --      -cc   cg         uggu 
5'   aaggug   ccg  ccagcauug    a
     ||||||   |||  |||||||||    c
3'   uuccgu   ggc  ggucguaau    u
   uc      uuu   -a         uaau 
Get sequence
Deep sequencing
324 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 68640949-68641005 [-]
intergenic
Database links

Mature sequence mdo-miR-7381-5p

Accession MIMAT0028818
Sequence

1 - 

aaggugccccgcgccagcauug

 - 22

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7381-3p

Accession MIMAT0028819
Sequence

36 - 

augcuggacgguuuugccuucu

 - 57

Get sequence
Deep sequencing309 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).