Stem-loop sequence mdo-mir-7380

AccessionMI0023966 (change log)
DescriptionMonodelphis domestica miR-7380 stem-loop
Stem-loop
   --       ag uc       caua  aag 
5'   agguccc  c  uacuccu    ga   c
     |||||||  |  |||||||    ||    
3'   uccaggg  g  augagga    cu   u
   ag       ca ua       cuca  gcu 
Get sequence
Deep sequencing
5679 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 67721626-67721685 [-]
intergenic
Database links

Mature sequence mdo-miR-7380-5p

Accession MIMAT0028816
Sequence

1 - 

aggucccagcucuacuccucau

 - 22

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7380-3p

Accession MIMAT0028817
Sequence

39 - 

caggaguaaugacgggaccuga

 - 60

Get sequence
Deep sequencing5664 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).