Stem-loop sequence mdo-mir-7379

AccessionMI0023965 (change log)
DescriptionMonodelphis domestica miR-7379 stem-loop
Stem-loop
   auau    --  -ua         auaa 
5'     cacc  ca   cauccagau    u
       ||||  ||   |||||||||    u
3'     gugg  gu   guaggucua    g
   -gau    ua  uuc         aaaa 
Get sequence
Deep sequencing
287 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 67706764-67706818 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7379
mdo-mir-12407chrX: 67707710-67707768 [-]
mdo-mir-7379chrX: 67706764-67706818 [-]
Database links

Mature sequence mdo-miR-7379-5p

Accession MIMAT0028814
Sequence

1 - 

auaucacccauacauccagaua

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7379-3p

Accession MIMAT0028815
Sequence

34 - 

ucuggaugcuuugaugguguag

 - 55

Get sequence
Deep sequencing286 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).