Stem-loop sequence mdo-mir-7378

AccessionMI0023964 (change log)
DescriptionMonodelphis domestica miR-7378 stem-loop
Stem-loop
   --g            cau  aa   gaua 
5'    ugggacaucuuc   gg  cug    u
      ||||||||||||   ||  |||    g
3'    acccuguagagg   cc  gau    c
   cug            auu  cc   auca 
Get sequence
Deep sequencing
671 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 67691162-67691220 [-]
intergenic
Database links

Mature sequence mdo-miR-7378-5p

Accession MIMAT0028812
Sequence

1 - 

gugggacaucuuccauggaacu

 - 22

Get sequence
Deep sequencing385 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7378-3p

Accession MIMAT0028813
Sequence

38 - 

ccccuuaggagaugucccaguc

 - 59

Get sequence
Deep sequencing285 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).