Stem-loop sequence mdo-mir-7377

AccessionMI0023963 (change log)
DescriptionMonodelphis domestica miR-7377 stem-loop
Stem-loop
   --         c      agga      ga 
5'   uagagguca ccagga    gaugua  a
     ||||||||| ||||||    ||||||  a
3'   gucuucagu gguccu    cuacgu  a
   uc         c      ---a      ga 
Get sequence
Deep sequencing
51220 reads, 620 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 15052712-15052769 [+]
intergenic
Database links

Mature sequence mdo-miR-7377-5p

Accession MIMAT0028810
Sequence

1 - 

uagaggucacccaggaaggaga

 - 22

Get sequence
Deep sequencing28430 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7377-3p

Accession MIMAT0028811
Sequence

37 - 

aucauccuggcugacuucugcu

 - 58

Get sequence
Deep sequencing22783 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).