Stem-loop sequence mdo-mir-7376

AccessionMI0023962 (change log)
DescriptionMonodelphis domestica miR-7376 stem-loop
Stem-loop
   --uag     -  a   u    u  c uguu 
5'      cgugg gg ggu agcu cu g    u
        ||||| || ||| |||| || |    u
3'      gcacc cc ccg ucga ga c    g
   ucaua     a  -   c    u  c uuug 
Get sequence
Deep sequencing
611 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57502218-57502278 [-]
intergenic
Database links

Mature sequence mdo-miR-7376-5p

Accession MIMAT0028808
Sequence

1 - 

uagcguggggagguuagcuucu

 - 22

Get sequence
Deep sequencing189 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7376-3p

Accession MIMAT0028809
Sequence

40 - 

uagcucgccccaccacgauacu

 - 61

Get sequence
Deep sequencing422 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).