Stem-loop sequence mdo-mir-7373d

AccessionMI0023961 (change log)
DescriptionMonodelphis domestica miR-7373d stem-loop
Stem-loop
   --         u      u  agaagu    u 
5'   aagcccuuu auuauu gu      gauc u
     ||||||||| |||||| ||      |||| a
3'   uucgggaag uaauaa cg      cuag u
   cg         -      -  ----au    u 
Get sequence
Deep sequencing
263 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44689543-44689601 [-]
sense
ENSMODT00000039010 ; FGF13-201; intron 4
antisense
Clustered miRNAs
< 10kb from mdo-mir-7373d
mdo-mir-7373dchrX: 44689543-44689601 [-]
mdo-mir-7373cchrX: 44688608-44688663 [-]
mdo-mir-7373fchrX: 44688086-44688149 [-]
mdo-mir-7373bchrX: 44687808-44687862 [-]
mdo-mir-7374dchrX: 44686439-44686494 [-]
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
Database links

Mature sequence mdo-miR-7373d-5p

Accession MIMAT0028806
Sequence

1 - 

aagcccuuuuauuauuuguagaa

 - 23

Get sequence
Deep sequencing46 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7373d-3p

Accession MIMAT0028807
Sequence

39 - 

uagcaauaaugaagggcuugc

 - 59

Get sequence
Deep sequencing216 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).