Stem-loop sequence mdo-mir-7374b

AccessionMI0023958 (change log)
DescriptionMonodelphis domestica miR-7374b stem-loop
Stem-loop
   -a       a   a   c      aua 
5'   agcccuu ccc ucu ucugau   u
     ||||||| ||| ||| ||||||    
3'   uugggga ggg aga agacua   u
   cg       a   a   u      agu 
Get sequence
Deep sequencing
630 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44682076-44682130 [-]
sense
ENSMODT00000039010 ; FGF13-201; intron 4
antisense
Clustered miRNAs
< 10kb from mdo-mir-7374b
mdo-mir-7373dchrX: 44689543-44689601 [-]
mdo-mir-7373cchrX: 44688608-44688663 [-]
mdo-mir-7373fchrX: 44688086-44688149 [-]
mdo-mir-7373bchrX: 44687808-44687862 [-]
mdo-mir-7374dchrX: 44686439-44686494 [-]
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
mdo-mir-7375dchrX: 44676822-44676879 [-]
mdo-mir-7375chrX: 44676538-44676594 [-]
mdo-mir-7375echrX: 44675952-44676008 [-]
mdo-mir-7375c-3chrX: 44674818-44674874 [-]
mdo-mir-7375c-1chrX: 44674536-44674592 [-]
mdo-mir-7375c-4chrX: 44674236-44674310 [-]
Database links

Mature sequence mdo-miR-7374b-5p

Accession MIMAT0028800
Sequence

1 - 

aagcccuuacccaucucucuga

 - 22

Get sequence
Deep sequencing574 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7374b-3p

Accession MIMAT0028801
Sequence

35 - 

agauagaagggaagggguugc

 - 55

Get sequence
Deep sequencing55 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).