Stem-loop sequence mdo-mir-7375

AccessionMI0023956 (change log)
DescriptionMonodelphis domestica miR-7375 stem-loop
Stem-loop
   --uagc    a    a  ga       ua 
5'       ccuu cccc cc  uuaauag  u
         |||| |||| ||  |||||||  u
3'       ggaa gggg gg  gauuguc  a
   ugucau    a    c  --       ua 
Get sequence
Deep sequencing
627 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44676538-44676594 [-]
sense
ENSMODT00000039010 ; FGF13-201; intron 4
antisense
Clustered miRNAs
< 10kb from mdo-mir-7375
mdo-mir-7374dchrX: 44686439-44686494 [-]
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
mdo-mir-7375dchrX: 44676822-44676879 [-]
mdo-mir-7375chrX: 44676538-44676594 [-]
mdo-mir-7375echrX: 44675952-44676008 [-]
mdo-mir-7375c-3chrX: 44674818-44674874 [-]
mdo-mir-7375c-1chrX: 44674536-44674592 [-]
mdo-mir-7375c-4chrX: 44674236-44674310 [-]
mdo-mir-7374achrX: 44670461-44670515 [-]
mdo-mir-12403chrX: 44668666-44668723 [-]
mdo-mir-7373echrX: 44667557-44667611 [-]
Database links

Mature sequence mdo-miR-7375-5p

Accession MIMAT0028796
Sequence

1 - 

uagcccuuaccccaccgauuaau

 - 23

Get sequence
Deep sequencing489 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7375-3p

Accession MIMAT0028797
Sequence

37 - 

uagggcggggaaagguacugu

 - 57

Get sequence
Deep sequencing124 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).