Stem-loop sequence mdo-mir-7373a-2

AccessionMI0023954 (change log)
DescriptionMonodelphis domestica miR-7373a-2 stem-loop
Gene family MIPF0001757; mir-7373
Stem-loop
   --     --cuu  uc         a   a 
5'   aagcc     uu  ugguaguug gug u
     |||||     ||  ||||||||| |||  
3'   uucgg     aa  gucgucaac cau u
   cg     aaauu  uc         a   u 
Get sequence
Deep sequencing
3230 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44666176-44666233 [-]
sense
ENSMODT00000039010 ; FGF13-201; intron 4
antisense
Clustered miRNAs
< 10kb from mdo-mir-7373a-2
mdo-mir-7375echrX: 44675952-44676008 [-]
mdo-mir-7375c-3chrX: 44674818-44674874 [-]
mdo-mir-7375c-1chrX: 44674536-44674592 [-]
mdo-mir-7375c-4chrX: 44674236-44674310 [-]
mdo-mir-7374achrX: 44670461-44670515 [-]
mdo-mir-12403chrX: 44668666-44668723 [-]
mdo-mir-7373echrX: 44667557-44667611 [-]
mdo-mir-7373a-2chrX: 44666176-44666233 [-]
mdo-mir-7373a-1chrX: 44665891-44665948 [-]
Database links

Mature sequence mdo-miR-7373a-5p

Accession MIMAT0028792
Sequence

1 - 

aagcccuuuuucugguaguug

 - 21

Get sequence
Deep sequencing26 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7373a-3p

Accession MIMAT0028793
Sequence

36 - 

acugcugcuaauuaaaggcuugc

 - 58

Get sequence
Deep sequencing6434 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).