Stem-loop sequence mdo-mir-7371j

AccessionMI0023952 (change log)
DescriptionMonodelphis domestica miR-7371j stem-loop
Gene family MIPF0001652; mir-7371
Stem-loop
   --c        c  -          guau   gu 
5'    ccuuguac ag augcucuauu    uga  g
      |||||||| || ||||||||||    |||   
3'    ggaacaug uc uacgagauaa    acu  c
   aau        u  g          ----   gu 
Get sequence
Deep sequencing
2149 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 38902981-38903043 [-]
antisense
Clustered miRNAs
< 10kb from mdo-mir-7371j
mdo-mir-7371jchrX: 38902981-38903043 [-]
mdo-mir-7371b-2chrX: 38902124-38902180 [-]
mdo-mir-7371hchrX: 38901554-38901611 [-]
mdo-mir-7371gchrX: 38901021-38901080 [-]
mdo-mir-7371fchrX: 38899299-38899356 [-]
mdo-mir-7371echrX: 38898554-38898609 [-]
mdo-mir-7371dchrX: 38897922-38897979 [-]
mdo-mir-7371cchrX: 38897274-38897333 [-]
mdo-mir-7371b-1chrX: 38896649-38896703 [-]
mdo-mir-7371achrX: 38895437-38895494 [-]
Database links

Mature sequence mdo-miR-7371j-5p

Accession MIMAT0028790
Sequence

1 - 

cccuuguaccagaugcucuau

 - 21

Get sequence
Deep sequencing32 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7371j-3p

Accession MIMAT0028791
Sequence

42 - 

agagcaugcuuguacaagguaa

 - 63

Get sequence
Deep sequencing2117 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).