Stem-loop sequence mdo-mir-7372

AccessionMI0023944 (change log)
DescriptionMonodelphis domestica miR-7372 stem-loop
Stem-loop
   --a  -  cu       a -a     aaggc 
5'    ug gg  ggcaaga g  guaag     u
      || ||  ||||||| |  |||||      
3'    ac cc  ccguucu c  cauuc     u
   cgg  a  uu       c ac     auagu 
Get sequence
Deep sequencing
332 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 453718398-453718457 [-]
sense
ENSMODT00000007191 ; FAM102A-201; exon 7
Database links

Mature sequence mdo-miR-7372-5p

Accession MIMAT0028776
Sequence

1 - 

augggcuggcaagaagaguaa

 - 21

Get sequence
Deep sequencing304 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7372-3p

Accession MIMAT0028777
Sequence

38 - 

accaccucuugccuuccacaggc

 - 60

Get sequence
Deep sequencing28 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).