Stem-loop sequence mdo-mir-7370i

AccessionMI0023941 (change log)
DescriptionMonodelphis domestica miR-7370i stem-loop
Stem-loop
   --        ca    c        gugaa 
5'   uuucacac  gaug ucccuuuu     u
     ||||||||  |||| ||||||||      
3'   aaagugug  cuau agggaaaa     u
   gg        uc    -        auguc 
Get sequence
Deep sequencing
1908 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 38866830-38866888 [-]
antisense
Database links

Mature sequence mdo-miR-7370i-5p

Accession MIMAT0028770
Sequence

1 - 

uuucacaccagaugcucccuuuu

 - 23

Get sequence
Deep sequencing247 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7370i-3p

Accession MIMAT0028771
Sequence

38 - 

aagggauauccugugugaaagg

 - 59

Get sequence
Deep sequencing1661 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).