Stem-loop sequence mdo-mir-15c

AccessionMI0023940 (change log)
DescriptionMonodelphis domestica miR-15c stem-loop
Gene family MIPF0001828; mir-15_2
Stem-loop
   --      a   c          gagau 
5'   agcagc cgc augguuugua     a
     |||||| ||| ||||||||||      
3'   uugucg gug uaccaaacau     c
   ca      g   c          agugg 
Get sequence
Deep sequencing
1877 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35734462-35734517 [-]
sense
ENSMODT00000040299 ; mdo-mir-15c-201; exon 1
antisense
Clustered miRNAs
< 10kb from mdo-mir-15c
mdo-mir-15cchrX: 35734462-35734517 [-]
mdo-mir-16bchrX: 35734295-35734357 [-]
Database links

Mature sequence mdo-miR-15c-5p

Accession MIMAT0028768
Sequence

1 - 

agcagcacgccaugguuugua

 - 21

Get sequence
Deep sequencing35 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-15c-3p

Accession MIMAT0028769
Sequence

36 - 

caaaccaucgugggcuguuac

 - 56

Get sequence
Deep sequencing1842 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).