Stem-loop sequence mdo-mir-18b

AccessionMI0023939 (change log)
DescriptionMonodelphis domestica miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ----u    u    c   u     uagu    uag 
5'      aagg gcau uag gcagu    gaug   u
        |||| |||| ||| |||||    ||||    
3'      uucc cgua auc cguca    cuau   u
   cggcc    u    a   c     ---u    gau 
Get sequence
Deep sequencing
4455 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35202855-35202919 [-]
sense
ENSMODT00000028324 ; mdo-mir-18b-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-18b
mdo-mir-106chrX: 35203046-35203114 [-]
mdo-mir-18bchrX: 35202855-35202919 [-]
mdo-mir-20bchrX: 35202543-35202603 [-]
mdo-mir-19b-2chrX: 35202389-35202447 [-]
mdo-mir-92a-2chrX: 35202231-35202295 [-]
mdo-mir-363chrX: 35202082-35202170 [-]
Database links

Mature sequence mdo-miR-18b-5p

Accession MIMAT0028766
Sequence

1 - 

uaaggugcaucuagugcaguuag

 - 23

Get sequence
Deep sequencing4361 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-18b-3p

Accession MIMAT0028767
Sequence

41 - 

uacugcccuaaaugcuccuuccggc

 - 65

Get sequence
Deep sequencing94 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).