Stem-loop sequence mdo-mir-20b

AccessionMI0023938 (change log)
DescriptionMonodelphis domestica miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --ca                 g     uuuu 
5'     aagugcucauagugcag uaguu    g
       ||||||||||||||||| |||||     
3'     uucacggguaucauguc aucag    c
   cgac                 -     uaaa 
Get sequence
Deep sequencing
2939 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35202543-35202603 [-]
sense
ENSMODT00000040296 ; mdo-mir-20b-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-20b
mdo-mir-106chrX: 35203046-35203114 [-]
mdo-mir-18bchrX: 35202855-35202919 [-]
mdo-mir-20bchrX: 35202543-35202603 [-]
mdo-mir-19b-2chrX: 35202389-35202447 [-]
mdo-mir-92a-2chrX: 35202231-35202295 [-]
mdo-mir-363chrX: 35202082-35202170 [-]
Database links

Mature sequence mdo-miR-20b-5p

Accession MIMAT0028764
Sequence

1 - 

caaagugcucauagugcagguag

 - 23

Get sequence
Deep sequencing2014 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-20b-3p

Accession MIMAT0028765
Sequence

40 - 

acuguacuaugggcacuucagc

 - 61

Get sequence
Deep sequencing924 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).