Stem-loop sequence mdo-mir-19b-2

AccessionMI0023937 (change log)
DescriptionMonodelphis domestica miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   --         -  uc     u    cu  g 
5'   aguuuugca gg  uugca cggc  au u
     ||||||||| ||  ||||| ||||  ||  
3'   ucaaaacgu cc  aacgu gucg  ua c
   ag         a  ua     -    -u  a 
Get sequence
Deep sequencing
6600 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35202389-35202447 [-]
sense
ENSMODT00000040393 ; mdo-mir-19b-2-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-19b-2
mdo-mir-106chrX: 35203046-35203114 [-]
mdo-mir-18bchrX: 35202855-35202919 [-]
mdo-mir-20bchrX: 35202543-35202603 [-]
mdo-mir-19b-2chrX: 35202389-35202447 [-]
mdo-mir-92a-2chrX: 35202231-35202295 [-]
mdo-mir-363chrX: 35202082-35202170 [-]
Database links

Mature sequence mdo-miR-19b-2-5p

Accession MIMAT0031025
Sequence

1 - 

aguuuugcaggucuugcaucggc

 - 23

Get sequence
Deep sequencing131 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-19b-3p

Accession MIMAT0004170
Sequence

37 - 

ugugcaaauccaugcaaaacuga

 - 59

Get sequence
Deep sequencing12967 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).