Stem-loop sequence mdo-mir-92a-2

AccessionMI0023936 (change log)
DescriptionMonodelphis domestica miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g     uu  u   u     ----ga  a 
5'   gggu gggau  gu gca uacuu      uc u
     |||| |||||  || ||| |||||      ||  
3'   uccg cccug  ca cgu augag      ag g
   ug    g     uu  -   u     aauauc  u 
Get sequence
Deep sequencing
62930 reads, 940 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35202231-35202295 [-]
sense
ENSMODT00000040309 ; mdo-mir-92a-2-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-92a-2
mdo-mir-106chrX: 35203046-35203114 [-]
mdo-mir-18bchrX: 35202855-35202919 [-]
mdo-mir-20bchrX: 35202543-35202603 [-]
mdo-mir-19b-2chrX: 35202389-35202447 [-]
mdo-mir-92a-2chrX: 35202231-35202295 [-]
mdo-mir-363chrX: 35202082-35202170 [-]
Database links

Mature sequence mdo-miR-92a-2-5p

Accession MIMAT0031050
Sequence

1 - 

ggguggggauuuguugcauuacu

 - 23

Get sequence
Deep sequencing131 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-92a-3p

Accession MIMAT0004171
Sequence

44 - 

uauugcacuugucccggccugu

 - 65

Get sequence
Deep sequencing160564 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).