Stem-loop sequence mdo-mir-7370

AccessionMI0023935 (change log)
DescriptionMonodelphis domestica miR-7370 stem-loop
Stem-loop
   --u        g       g  ----a   ua 
5'    gaccccag uaggaag ag     gca  c
      |||||||| ||||||| ||     |||  u
3'    uugggguc guccuuc uc     cgu  g
   uuu        a       a  cauac   cu 
Get sequence
Deep sequencing
6239 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 31811772-31811832 [-]
sense
ENSMODT00000029118 ; AIFM1-201; intron 1
ENSMODT00000019591 ; ENOX2-201; intron 10
Database links

Mature sequence mdo-miR-7370-5p

Accession MIMAT0028762
Sequence

1 - 

ugaccccagguaggaaggagagc

 - 23

Get sequence
Deep sequencing6232 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7370-3p

Accession MIMAT0028763
Sequence

39 - 

ccuacuuccugacugggguuuuu

 - 61

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).