Stem-loop sequence mdo-mir-7369

AccessionMI0023934 (change log)
DescriptionMonodelphis domestica miR-7369 stem-loop
Stem-loop
   --  a          a a  a    ccuag 
5'   ca ugcucagcug g cu caug     a
     || |||||||||| | || ||||      
3'   gu acgagucgac c ga guac     a
   uc  a          - a  -    cauug 
Get sequence
Deep sequencing
1788 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 29144054-29144111 [-]
antisense
Database links

Mature sequence mdo-miR-7369-5p

Accession MIMAT0028760
Sequence

1 - 

caaugcucagcugagacuacaug

 - 23

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7369-3p

Accession MIMAT0028761
Sequence

38 - 

ugagaccagcugagcaaugcu

 - 58

Get sequence
Deep sequencing1781 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).