Stem-loop sequence mdo-mir-7368

AccessionMI0023933 (change log)
DescriptionMonodelphis domestica miR-7368 stem-loop
Stem-loop
   --a       aa      ug    uguaa 
5'    guaggag  gggcug  gauc     c
      |||||||  ||||||  ||||      
3'    cgucuuc  cucgac  cugg     u
   auc       ca      ca    uggag 
Get sequence
Deep sequencing
11719 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 26897674-26897731 [-]
sense
ENSMODT00000026531 ; ARHGEF9-201; intron 10
Database links

Mature sequence mdo-miR-7368-5p

Accession MIMAT0028758
Sequence

1 - 

aguaggagaagggcuguggau

 - 21

Get sequence
Deep sequencing11424 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7368-3p

Accession MIMAT0028759
Sequence

38 - 

caccagcucaccuucugccua

 - 58

Get sequence
Deep sequencing292 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).