Stem-loop sequence mdo-mir-7367

AccessionMI0023932 (change log)
DescriptionMonodelphis domestica miR-7367 stem-loop
Stem-loop
   ----uu    cuu           aa   -cuc    c 
5'       gggc   aaagggagcag  gcc    caaa a
         ||||   |||||||||||  |||    ||||  
3'       cccg   uuucccucguu  cgg    guuu g
   aagacc    --u           -c   uaca    c 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 14442861-14442930 [-]
sense
ENSMODT00000014778 ; HCFC1-201; exon 22
Database links

Mature sequence mdo-miR-7367-5p

Accession MIMAT0028756
Sequence

1 - 

uugggccuuaaagggagcagaag

 - 23

Get sequence
Deep sequencing42 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7367-3p

Accession MIMAT0028757
Sequence

48 - 

cuugcucccuuuugcccccagaa

 - 70

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).