Stem-loop sequence mdo-mir-1544d

AccessionMI0023931 (change log)
DescriptionMonodelphis domestica miR-1544d stem-loop
Gene family MIPF0001645; mir-1544
Stem-loop
   --ugcac         u  u  c  uu acu 
5'        ccagggaua aa ag gg  c   u
          ||||||||| || || ||  |    
3'        ggucccuau uu uc cc  g   g
   uggucau         c  u  -  cc aag 
Get sequence
Deep sequencing
248784 reads, 3.94e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 14010514-14010574 [-]
sense
ENSMODT00000040853 ; mdo-mir-1544d-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-1544d
mdo-mir-1544dchrX: 14010514-14010574 [-]
mdo-mir-1545cchrX: 14007943-14008000 [-]
mdo-mir-1544achrX: 14005428-14005509 [-]
mdo-mir-1545achrX: 14003847-14003918 [-]
Database links

Mature sequence mdo-miR-1544d-5p

Accession MIMAT0028754
Sequence

1 - 

ugcacccagggauauaauagcgg

 - 23

Get sequence
Deep sequencing245134 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-1544d-3p

Accession MIMAT0028755
Sequence

39 - 

ccuuuucuaucccugguacuggu

 - 61

Get sequence
Deep sequencing3650 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).