Stem-loop sequence mdo-mir-1545c

AccessionMI0023930 (change log)
DescriptionMonodelphis domestica miR-1545c stem-loop
Gene family MIPF0001711; mir-1545
Stem-loop
   --     ccu     a  u   a  ucccc 
5'   agugc   gggau ga aag gg     u
     |||||   ||||| || ||| ||      
3'   ucaug   cccua cu uuc cc     u
   ug     -cu     c  -   a  uaaaa 
Get sequence
Deep sequencing
18357 reads, 220 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 14007943-14008000 [-]
sense
ENSMODT00000040819 ; mdo-mir-1545c-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-1545c
mdo-mir-1544dchrX: 14010514-14010574 [-]
mdo-mir-1545cchrX: 14007943-14008000 [-]
mdo-mir-1544achrX: 14005428-14005509 [-]
mdo-mir-1545achrX: 14003847-14003918 [-]
mdo-mir-1544c-6chrX: 13998842-13998902 [-]
Database links

Mature sequence mdo-miR-1545c-5p

Accession MIMAT0028752
Sequence

1 - 

agugcccugggauagauaagaggu

 - 24

Get sequence
Deep sequencing955 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1545c-3p

Accession MIMAT0028753
Sequence

37 - 

cacuuuccaucccucguacugu

 - 58

Get sequence
Deep sequencing17402 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).