Stem-loop sequence mdo-mir-1544e-3

AccessionMI0023928 (change log)
DescriptionMonodelphis domestica miR-1544e-3 stem-loop
Gene family MIPF0001645; mir-1544
Stem-loop
   --gcgc         u  u  c     au 
5'       ccagggaua aa ag gguuu  u
         ||||||||| || || |||||  u
3'       ggucccuau uu uc ccaga  c
   ggucau         c  u  a     aa 
Get sequence
Deep sequencing
11919 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13983180-13983238 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1544e-3
mdo-mir-1545b-3chrX: 13985682-13985740 [-]
mdo-mir-1544e-3chrX: 13983180-13983238 [-]
mdo-mir-1544c-5chrX: 13978268-13978328 [-]
mdo-mir-1545g-3chrX: 13975864-13975923 [-]
mdo-mir-1544e-2chrX: 13973354-13973412 [-]
Database links

Mature sequence mdo-miR-1544e-5p

Accession MIMAT0031033
Sequence

1 - 

gcgcccagggauauaauagcgg

 - 22

Get sequence
Deep sequencing24401 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1544e-3p

Accession MIMAT0031034
Sequence

38 - 

acuuuucuaucccugguacugg

 - 59

Get sequence
Deep sequencing11520 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).