Stem-loop sequence mdo-mir-1545b-1

AccessionMI0023926 (change log)
DescriptionMonodelphis domestica miR-1545b-1 stem-loop
Gene family MIPF0001711; mir-1545
Stem-loop
   --     u ug    a  u   -c   cuc 
5'   agugu c  ggau ga agg  gau   c
     ||||| |  |||| || |||  |||   u
3'   uuacg g  ccua cu ucc  cua   u
   gg     - gu    c  u   ac   acg 
Get sequence
Deep sequencing
58127 reads, 1.02e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13966015-13966073 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1545b-1
mdo-mir-1545g-3chrX: 13975864-13975923 [-]
mdo-mir-1544e-2chrX: 13973354-13973412 [-]
mdo-mir-1545b-2chrX: 13970934-13970992 [-]
mdo-mir-1544c-4chrX: 13968430-13968490 [-]
mdo-mir-1545b-1chrX: 13966015-13966073 [-]
mdo-mir-1544c-3chrX: 13960783-13960843 [-]
mdo-mir-1545g-2chrX: 13958257-13958316 [-]
Database links

Mature sequence mdo-miR-1545b-5p

Accession MIMAT0028750
Sequence

1 - 

aguguucugggauagauaggcga

 - 23

Get sequence
Deep sequencing171200 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-1545b-3p

Accession MIMAT0028751
Sequence

38 - 

accuuuccauccugggcauugg

 - 59

Get sequence
Deep sequencing2098 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).