Stem-loop sequence mdo-mir-7366

AccessionMI0023925 (change log)
DescriptionMonodelphis domestica miR-7366 stem-loop
Stem-loop
   --        c  -u   ug    cg g ug c 
5'   ggagggaa cc  cuc  gaga  u c  g c
     |||||||| ||  |||  ||||  | |  |  
3'   ucuuccuu gg  gag  cucu  a g  u u
   cg        c  uc   gu    -- g gu g 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 452950974-452951036 [-]
sense
ENSMODT00000005741 ; SLC31A2-201; intron 2
Database links

Mature sequence mdo-miR-7366-5p

Accession MIMAT0028748
Sequence

1 - 

ggagggaacccucucuggaga

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7366-3p

Accession MIMAT0028749
Sequence

42 - 

ucuggagcuggcuuccuucugc

 - 63

Get sequence
Deep sequencing21 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).