Stem-loop sequence mdo-mir-1544c-1

AccessionMI0023917 (change log)
DescriptionMonodelphis domestica miR-1544c-1 stem-loop
Gene family MIPF0001645; mir-1544
Stem-loop
   --ugcac         u  u  c   aaac 
5'        ccagggaua aa ag ggu    u
          ||||||||| || || |||    u
3'        ggucccuau uu uc cca    c
   uggucau         c  u  a   gaaa 
Get sequence
Deep sequencing
249576 reads, 3.94e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13933823-13933883 [-]
sense
ENSMODT00000040789 ; mdo-mir-1544c-6-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-1544c-1
mdo-mir-1545fchrX: 13941604-13941663 [-]
mdo-mir-1544e-1chrX: 13939064-13939122 [-]
mdo-mir-1545e-2chrX: 13935990-13936048 [-]
mdo-mir-1544c-1chrX: 13933823-13933883 [-]
mdo-mir-1545e-1chrX: 13930496-13930554 [-]
mdo-mir-1545g-1chrX: 13927964-13928023 [-]
mdo-mir-1545d-1chrX: 13926550-13926608 [-]
Database links

Mature sequence mdo-miR-1544c-5p

Accession MIMAT0028746
Sequence

1 - 

ugcacccagggauauaauagcgg

 - 23

Get sequence
Deep sequencing1471134 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-1544c-3p

Accession MIMAT0028747
Sequence

39 - 

acuuuucuaucccugguacuggu

 - 61

Get sequence
Deep sequencing26322 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).