Stem-loop sequence mdo-mir-1544b

AccessionMI0023916 (change log)
DescriptionMonodelphis domestica miR-1544b stem-loop
Gene family MIPF0001645; mir-1544
Stem-loop
   --acac            c  --c g   a 
5'       ccagggauagaa ag   a uuc c
         |||||||||||| ||   | ||| u
3'       ggucccuaucuu uc   u aag u
   gaccau            u  ccc g   u 
Get sequence
Deep sequencing
4182 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13923740-13923798 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1544b
mdo-mir-1545e-1chrX: 13930496-13930554 [-]
mdo-mir-1545g-1chrX: 13927964-13928023 [-]
mdo-mir-1545d-1chrX: 13926550-13926608 [-]
mdo-mir-1544bchrX: 13923740-13923798 [-]
mdo-mir-1544fchrX: 13921267-13921326 [-]
Database links

Mature sequence mdo-miR-1544b-5p

Accession MIMAT0028744
Sequence

1 - 

acacccagggauagaacagcag

 - 22

Get sequence
Deep sequencing3882 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1544b-3p

Accession MIMAT0028745
Sequence

38 - 

ccuuuucuaucccugguaccag

 - 59

Get sequence
Deep sequencing299 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).