Stem-loop sequence mdo-mir-7365

AccessionMI0023915 (change log)
DescriptionMonodelphis domestica miR-7365 stem-loop
Stem-loop
   --u        c    uug   a   u   caa 
5'    gaaucgau ggcu   cug ggu gga   c
      |||||||| ||||   ||| ||| |||    
3'    cuuagcua ccga   gac cca cuu   u
   uuc        c    --a   -   -   uac 
Get sequence
Deep sequencing
180221 reads, 2.42e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 11424683-11424744 [-]
sense
ENSMODT00000010380 ; PNCK-201; intron 2
Database links

Mature sequence mdo-miR-7365-5p

Accession MIMAT0028742
Sequence

1 - 

ugaaucgaucggcuuugcugagg

 - 23

Get sequence
Deep sequencing130746 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7365-3p

Accession MIMAT0028743
Sequence

42 - 

ccagaagcccaucgauuccuu

 - 62

Get sequence
Deep sequencing49461 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).