Stem-loop sequence mdo-mir-7364

AccessionMI0023914 (change log)
DescriptionMonodelphis domestica miR-7364 stem-loop
Stem-loop
   --g        cu  a    a    caaag   cuu 
5'    ugggggaa  aa guag ccac     agc   u
      ||||||||  || |||| ||||     |||    
3'    acccccuu  uu cguc ggug     ucg   u
   ggg        cc  c    -    --uaa   auu 
Get sequence
Deep sequencing
315 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 3218257-3218325 [+]
sense
ENSMODT00000039733 ; 3'UTR (exon 4)
Database links

Mature sequence mdo-miR-7364-5p

Accession MIMAT0028740
Sequence

1 - 

gugggggaacuaaaguagacc

 - 21

Get sequence
Deep sequencing292 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7364-3p

Accession MIMAT0028741
Sequence

49 - 

gcugccuuccuucccccaggg

 - 69

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).