Stem-loop sequence mdo-mir-7363

AccessionMI0023913 (change log)
DescriptionMonodelphis domestica miR-7363 stem-loop
Stem-loop
   --           a            ag a 
5'   aucacagaucc uuuggguauuuu  u u
     ||||||||||| ||||||||||||  |  
3'   uagugucuagg aaacccaugaag  g g
   uu           -            ga u 
Get sequence
Deep sequencing
52575 reads, 1.04e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 7282210-7282268 [-]
sense
ENSMODT00000014860 ; MID2-201; intron 3
Database links

Mature sequence mdo-miR-7363-5p

Accession MIMAT0028738
Sequence

1 - 

aucacagauccauuuggguauuu

 - 23

Get sequence
Deep sequencing220 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7363-3p

Accession MIMAT0028739
Sequence

38 - 

guacccaaaggaucugugauuu

 - 59

Get sequence
Deep sequencing52355 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).