Stem-loop sequence mdo-mir-7362

AccessionMI0023912 (change log)
DescriptionMonodelphis domestica miR-7362 stem-loop
Stem-loop
   --a   c    c   c   u      -  u 
5'    cag guug ccc cug gguucu gg a
      ||| |||| ||| ||| |||||| ||  
3'    guc caac ggg gac ccagga cc u
   cga   u    c   a   -      a  u 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 67204021-67204078 [+]
intergenic
Database links

Mature sequence mdo-miR-7362-5p

Accession MIMAT0028736
Sequence

1 - 

acagcguugccccccugugg

 - 20

Get sequence
Deep sequencing41 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7362-3p

Accession MIMAT0028737
Sequence

39 - 

ccagagggccaacucugagc

 - 58

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).