Stem-loop sequence mdo-mir-7361

AccessionMI0023911 (change log)
DescriptionMonodelphis domestica miR-7361 stem-loop
Stem-loop
   --u      c       -       aaauu   a 
5'    gggacc aagaggg gugagga     cug g
      |||||| ||||||| |||||||     |||  
3'    cccugg uucucuc cacuucu     gac c
   gac      u       u       -----   u 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 449545256-449545317 [-]
sense
ENSMODT00000017482 ; ZNF335-201; intron 25
Database links

Mature sequence mdo-miR-7361-5p

Accession MIMAT0028734
Sequence

1 - 

ugggacccaagaggggugagga

 - 22

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7361-3p

Accession MIMAT0028735
Sequence

40 - 

uucacucucucuuugguccccag

 - 62

Get sequence
Deep sequencing25 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).