Stem-loop sequence mdo-mir-7360-9

AccessionMI0023910 (change log)
DescriptionMonodelphis domestica miR-7360-9 stem-loop
Gene family MIPF0001649; mir-7360
Stem-loop
   --   uu     a          c     a 
5'   ucc  ucugu gguauaauau uuaau a
     |||  ||||| |||||||||| ||||| a
3'   agg  agaca cuauguuaua aauua a
   uc   uu     -          -     a 
Get sequence
Deep sequencing
15511 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 66805279-66805337 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7360-9
mdo-mir-7360-1chrX: 66802580-66802638 [+]
mdo-mir-7359a-1chrX: 66803745-66803800 [+]
mdo-mir-7360-9chrX: 66805279-66805337 [+]
mdo-mir-7359a-2chrX: 66806444-66806499 [+]
mdo-mir-7360-2chrX: 66807977-66808035 [+]
mdo-mir-7359b-1chrX: 66809142-66809197 [+]
mdo-mir-7360-3chrX: 66810676-66810734 [+]
mdo-mir-7359b-2chrX: 66811841-66811896 [+]
mdo-mir-7360-4chrX: 66813375-66813433 [+]
mdo-mir-7359b-3chrX: 66814540-66814595 [+]
Database links

Mature sequence mdo-miR-7360-9-5p

Accession MIMAT0031118
Sequence

1 - 

uccuuucuguagguauaauaucu

 - 23

Get sequence
Deep sequencing41 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7360-3p

Accession MIMAT0028733
Sequence

38 - 

auauuguaucacagauuggacu

 - 59

Get sequence
Deep sequencing139230 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).