Stem-loop sequence mdo-mir-7360-6

AccessionMI0023903 (change log)
DescriptionMonodelphis domestica miR-7360-6 stem-loop
Gene family MIPF0001649; mir-7360
Stem-loop
   --   uu     a            u   a 
5'   ucc  ucugu gguauaauauuu aau a
     |||  ||||| |||||||||||| ||| a
3'   agg  agaca cuauguuauaaa uua a
   uc   uu     -            -   a 
Get sequence
Deep sequencing
15513 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001582510.1: 1899-1957 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7360-6
mdo-mir-7360-8NW_001582510.1: 8661-8719 [-]
mdo-mir-7359a-5NW_001582510.1: 7499-7554 [-]
mdo-mir-7360-7NW_001582510.1: 5963-6021 [-]
mdo-mir-7359b-4NW_001582510.1: 4802-4857 [-]
mdo-mir-7360-6NW_001582510.1: 1899-1957 [-]
mdo-mir-7359a-4NW_001582510.1: 737-792 [-]
Database links

Mature sequence mdo-miR-7360-5p

Accession MIMAT0028732
Sequence

1 - 

uccuuucuguagguauaauauuu

 - 23

Get sequence
Deep sequencing328 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7360-3p

Accession MIMAT0028733
Sequence

38 - 

auauuguaucacagauuggacu

 - 59

Get sequence
Deep sequencing139230 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).