Stem-loop sequence mdo-mir-7359a-4

AccessionMI0023896 (change log)
DescriptionMonodelphis domestica miR-7359a-4 stem-loop
Gene family MIPF0001650; mir-7359
Stem-loop
   --u              c  u   c  u 
5'    agaaugugaaaggc au aga au u
      |||||||||||||| || ||| ||  
3'    ucuuacacuuuccg ua ucu ug u
   gau              a  c   u  u 
Get sequence
Deep sequencing
2040 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001582510.1: 737-792 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7359a-4
mdo-mir-7360-8NW_001582510.1: 8661-8719 [-]
mdo-mir-7359a-5NW_001582510.1: 7499-7554 [-]
mdo-mir-7360-7NW_001582510.1: 5963-6021 [-]
mdo-mir-7359b-4NW_001582510.1: 4802-4857 [-]
mdo-mir-7360-6NW_001582510.1: 1899-1957 [-]
mdo-mir-7359a-4NW_001582510.1: 737-792 [-]
Database links

Mature sequence mdo-miR-7359-5p

Accession MIMAT0028730
Sequence

1 - 

uagaaugugaaaggccauuaga

 - 22

Get sequence
Deep sequencing18027 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7359a-3p

Accession MIMAT0028731
Sequence

35 - 

ucauagccuuucacauucuuag

 - 56

Get sequence
Deep sequencing185 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).