Stem-loop sequence mdo-mir-7359a-2

AccessionMI0023894 (change log)
DescriptionMonodelphis domestica miR-7359a-2 stem-loop
Gene family MIPF0001650; mir-7359
Stem-loop
   --u              c  u   c  u 
5'    agaaugugaaaggc au aga au u
      |||||||||||||| || ||| ||  
3'    ucuuacacuuuccg ua ucu ug u
   gau              a  c   u  u 
Get sequence
Deep sequencing
2040 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 66806444-66806499 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7359a-2
mdo-mir-7360-1chrX: 66802580-66802638 [+]
mdo-mir-7359a-1chrX: 66803745-66803800 [+]
mdo-mir-7360-9chrX: 66805279-66805337 [+]
mdo-mir-7359a-2chrX: 66806444-66806499 [+]
mdo-mir-7360-2chrX: 66807977-66808035 [+]
mdo-mir-7359b-1chrX: 66809142-66809197 [+]
mdo-mir-7360-3chrX: 66810676-66810734 [+]
mdo-mir-7359b-2chrX: 66811841-66811896 [+]
mdo-mir-7360-4chrX: 66813375-66813433 [+]
mdo-mir-7359b-3chrX: 66814540-66814595 [+]
mdo-mir-7360-5chrX: 66816074-66816132 [+]
Database links

Mature sequence mdo-miR-7359-5p

Accession MIMAT0028730
Sequence

1 - 

uagaaugugaaaggccauuaga

 - 22

Get sequence
Deep sequencing18027 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7359a-3p

Accession MIMAT0028731
Sequence

35 - 

ucauagccuuucacauucuuag

 - 56

Get sequence
Deep sequencing185 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).